Soal Dan Kunci Jawaban Sel Molekuler, Mikrobiologi, dan Bioteknologi - KakaKiky | Blog Edukasi
News Update
Loading...

Jumat, 10 Juli 2020

Soal Dan Kunci Jawaban Sel Molekuler, Mikrobiologi, dan Bioteknologi

soal dan kunci jawaban sel molekuler dan bioteknologi
Soal dan kunci jawaban
KakaKiky - Berikut ini adalah kumpulan soal tentang biologi sel molekuler, mikrobiologi dan bioteknologi lengkap dengan kunci jawabannya. Gunakan soal dan pembahasan di bawah ini sebagai bahan belajar untuk mendapatkan nilai biologi yang lebih baik.

Kunci jawaban soal sel molekuler, mikrobiologi dan bioteknologi

1. Seorang ilmuwan melakukan percobaan untuk memisahkan membran dalam mitokondria dari mitokondria. Setelah membran dalam terpisah, membran dalam tersebut kemudian diberikan perlakuan tertentu sehingga F1 dari ATP sintetasenya rusak. Dari semua proses berikut:
  1. Oksidasi NADH
  2. Produksi H2O dari O2
  3. Terbentuknya gradien proton
  4. Fosforilasi ADP
Manakah yang tidak akan terjadi akibat perlakuan tersebut?
A. 1,2,3,4
B. 2,4
C. 1,3,2
D. 4 saja
E. 3 saja

2. Sel di dalam tubuh yang tidak dapat memanfaatkan senyawa keton sebagai sumber energinya adalah …
A. Sel darah putih
B. Sel-sel penyusun hati
C. Sel-sel di otak
D. Sel darah merah
E. Sel penyusun otot

3. Polisistronik adalah suatu istilah yang dipergunakan untuk menyatakan hasil dari satu proses transkripsi yang hasil transkripsinya terdiri atas beberapa gen. sebagian besar transkripsi yang bersifat polisistronik ini terdapat pada prokariot, namun beberapa prokariot memiliki hasil transkripsi yang bersifat polisistronik. Berikut yang merupakan hasil transkripsi yang bersifat polisistronik pada eukariot adalah …
A. Hasil transkripsi dari gen-gen yang mengkode protein ribosom
B. Hasil transkripsi dari gen-gen yang mengkode protein histon
C. Hasil transkripsi dari gen-gen yang mengkode rRNA
D. Hasil transkripsi dari gen-gen yang mengkode protein integral
E. Hasil transkripsi dari gen-gen yang mengkode haemoglobin

4. Atenuasi merupakan salah satu proses pengaturan pada Trp operon dari bakteri. Sistem ini diatur pada Trp E dari Trp operon. Trp E merupakan gen paling awal *upstream) dari Trp operon. Trp E ini ditanskripsi baik ketika ada triptofan maupun tidak. Ketika ada triptofan maka Trp E yang tela ditranskripsi selanjutnya akan ditranslasi oleh ribosom, akibatnya akan terbentuk terminasi transkripsi sehingga gen-gen lain dari Trp operon tidak di transkripsi. Tapi apabila tidak terdapat triptofan, maka ribosom akan berhenti pada kodon yang mengkode triptofan. Akibatnya translasi dari Trp E akan terhenti dan proses transkripsi dapat dilanjutkan sampai akhir (semua gen pada Trp operon di transkirpsi). Berdasarkan keterangan tersebut, maka pernyataan manakah yang salah mengenai sistem atenuasi dan Trp Operon?
A. Proses atenuasi terjadi di dalam sitoplasma.
B. Karena ribosom terhenti pada Trp E maka gen-gen lain dari Trp operon baru akan di translasi apabila terdapat triptofan di dalam sitoplasma.
C. Hasil transkripsi dari Trp operon bersifat polisistronik.
D. Atenuasi berfungsi untuk mencegah diroduksinya enzim yang mensintesis triptofan ketika kada triptofan di dalam sel sangat banyak.
E. Semua jawaban di atas adalah benar.

5. Untuk membuktikan bahwa proses pembelahan sel dipengaruhi oleh siklus keberadaan protein di dalam sel maka dua orang ilmuwan melakukan fusi 2 sel dari fase yang berbeda. Isilah B untuk eksperimen yang menurut anda hasilnya benar dan S untuk eksperimen yang hasilnya salah.

No Eksperimen Hasil Jawaban
1 Fusi sel pada fase G2 dengan sel pada fase S Inti sel G2 mengalami replikasi DNA S
2 Fusi sel pada fase G2 dengan sel pada fase M Kromatin pada inti G2 berubah menjadi kromosom dengan tiap kromosom hanya memiliki satu sentromer dan 2 lengan S
3 Fusi sel pada G1 dengan sel pada fase S Inti sel G1 akan mengalami replikasi DNA B

6. Suatu cara yang mudah untuk mengisolasi spesies Bacillus dan Clostridium secara spesifik dari tanah adalah dengan:
A. Menumbuhkannya secara aerobik pada medium yang mengandung glukosa.
B. Menumbuhkannya pada suhu tinggi.
C. Memanaskan tanah untuk membunuh semua sel vegetatif dan kemudian memungkinkan semua spora dari organisme ini untuk “berkecambah” dan tumbuh.
E. Menumbuhkannya secara anaerobik pada medium yang mengandung glukosa.

7. Perbedaan antara virus flu burung H5N1 hasil replikasi pada anak yang kurus dengan H5N1 hasil replikasi pada ayam di peternakan terletak di:
A. Komposisi lipid virus
B. Macam-macam molekul RNA
C. Komposisi protein kapsid
D. Tipe hemaglutinin

8. Orang sakit flu diberi antibiotik untuk:
A. Menghambat perkembangbiakan virus flu
B. Menghambat infeksi sekunder oleh bakteri
C. Meningkatkan fungsi sistem imun pasien
D. Menghambat pertumbuhan sel yang diserang virus

9. Bahan di bawah ini dapat dijadikan vaksin terhadap flu, kecuali:
A. Virus yang dimatikan
B. Protein hemglutinin
C. Peptida yang merupakan bagian dari neuroaminidase.
D. RNA virus

10. Virus flu menyerang sel-sel saluran pernafasan atas dan tidak menyerang sel-sel yang lain karena:
A. Sel lain tidak mempunyai reseptor untuk virus flu
B. Virus lebih mudah untuk masuk ke dalam tubuh melalui saluran pernafasan
C. Hanya saluran pernafasan yang mempunyai komponen-komponen yang diperlukan untuk replikasi virus
D. Virus lebih mudah untuk keluar tubuh lewat saluran pernafasan.

11. Bila seseorang yang sakit flu akibat virus tipe H3N2 terserang flu burung H5N1 maka virus tipe di bawah ini dapat muncul, kecuali:
A. H3N1
B. H2N3
C. H5N2
D. H5N1

12. Berikut ini yang merupkaan komponen yang tidak diperlukan dalam proses replikasi DNA secara in vivo adalah …
A. DNA polimerase
B. dAMP, dTMP, dCMP, dGMP
C. RNA polimerasi (primase)
D. DNA templat
E. Protein yang mencegah bergabungnya dua rantai induk pada saat replikasi.

13. Diketahui bahwa suatu mRNA memiliki urutan basa sebagai berikut
5AACGGUUUUAUGGAUAAACAA … (45 basa) … GGGAUGCGGAGAUAAGAAUUU3
Dari keterangan di atas, hasil translasi dari mRNA tersebut adalah …
A. Rantai polipeptida dengan 29 asam amino
B. Rantai polipeptida dengan 28 ikatan peptida
C. Rantai polipeptida dengan 23 asam amino
D. Rantai polipeptida dengan 23 ikatan peptida
E. Oligopeptida dengan 3 asam amino

14. Semua fenomena sel di bawah ini melibatkan aktivitas dari filamen aktin, kecuali …
A. Pergerakan amuba
B. Aliran sitoplasma
C. Sitokinesis
D. Kontraksi otot
E. Pergerakan flagel pada bakteri

Nah sobat, itulah kumpulan soal tentang biologi sel molekuler, mikrobiologi dan bioteknologi lengkap dengan kunci jawabannya. Semoga pembahasan di atas dapat bermanfaat bagi kalian yang membacanya. Cukup sekian postingan kali ini, wassalamu’alaikum and Be Prepared!

Share with your friends

Give us your opinion

Notification
KakaKiky.id Adalah sebuah blog yang bergerak di bidang pendidikan. KakaKiky update postingan setiap harinya, bagi kamu yang tidak ingin ketinggalan informasi update terbaru, jangan lupa untuk subscribe menggunakan email kamu. Wassalamu'alaikum and Be Prepared!
Done